레포트 (96)
well에 tube를 넣고 반응시킨다.-PCRDNA polymerase, Template DNA, primers, dNTPs mixture, Reaction buffer, PCR tube, 증류수, pipette tip, pipettePlasmid DNA extractionPlasmid를 분리해내는 방법은 추출량에 따라 miniprep, midiprep, maxiprep 이 있다.기본적인 원리는 세균의 Cell wall을 Alkali lyssis method를 통해 깨부
7페이지 | 2,000원 | 2015.07.25
well에 tube를 넣고 반응시킨다.-PCRDNA polymerase, Template DNA, primers, dNTPs mixture, Reaction buffer, PCR tube, 증류수, pipette tip, pipettePlasmid DNA extractionPlasmid를 분리해내는 방법은 추출량에 따라 miniprep, midiprep, maxiprep 이 있다.기본적인 원리는 세균의 Cell wall을 Alkali lyssis method를 통해 깨부
5페이지 | 1,500원 | 2013.12.23
well에 loading 한다.11. PCR product sample, Plasmid DNA sample, Plasmid DNA - 제한효소 sample 순으로 넣어준다.12. 100V 전압으로 약 25분간 전기영동을 진행한다.Ⅳ. 실험결과 및 결론 (Data and Results)실험결과 1전기영동 내린 모습LadderPCR product (EGFP : 720 bp)Plasmid DNA (pET-41a)Plasmid DNA - 제한효소 (pET-41a-HindIII : 5933 bp)실험
16페이지 | 3,000원 | 2023.09.25
well에 넣고, PCR product 3ul를 두 번째 well부터 순서대로 넣는다.미리 준비된 0.8% gel에는 micropipet을 사용해 HindIII marker 5ul를 첫 번째 well에 넣고, DNA 추출액 5ul를 2ul loading dye tube에 넣어 혼합한 후에 두 번째 well부터 5ul씩 micropipet를 사용해 순서대로 넣는다.전기영동장치 전원코드를 연결하고 뚜껑 홈이 금
10페이지 | 2,500원 | 2023.08.27
PCR과 Gel running을 이용해 대장균의 plasmid 관찰실험
well 별로 DNA 절편이 이동한 거리가 다르다는 것을 알 수 있다. 이것을 통해 채취한 colony 별로 서로 다른 플라스미드가 들어갔음을 알 수 있고 이를 통해 W&B colony의 배양과 white colony에 무작위적인 플라스미드의 유입이 잘 이뤄져 실험이 성공적으로 진행되었다고 결론 내릴 수 있다.Ⅴ. Reference(1). Bouchard
8페이지 | 1,500원 | 2020.12.19
컴퓨터공학 프로젝트_좌석예매시스템(java&oracle)
well with existingstandards such as the Simple API for XML (SAX) and the DocumentObject Model (DOM), it is not an abstraction layer orenhancement to those APIs. Rather, it seeks to provide a robust,light-weight means of reading and writing XML data without thecomplex and memory-consumptive options that current APIofferings provide.2000-2007, Jason HunterBSD/Apache style, see LICENSE.txtS
1페이지 | 29,000원 | 2019.05.24
well.AIGs bailout occurred just as individual homeowners found themselves unable to repay debt and national economies fell into recession. At the same time, many Americans resented how their tax dollars were used on a massive scale to rescue AIG. 1. CLOSING CASEGlobal ConnectionsIn the wake of crisis, governments in various countries increased efforts to regulate the banking and finance sec
28페이지 | 2,500원 | 2019.01.07
primer는 NOD2를 식별하는 데 사용하였다 :forward primer 5 CGGCGTTCCTCAGGAAGTAC3 역방향 primer 5 ACCCCGGGCTCATGATG3다음 primer는 PCR반응에서 actin을 식별하는데 사용되었다.forward primer 5GCTCGTCGTCGACAACGGCTC3역방향 primer 5CAAACATGATCTGGGTCATCTTCTC3실시간 RT-qPCR 반응은 제조자의 지시에 따라 ABI PRISM 7700 Sequence Dtector(Applied Bio
16페이지 | 2,300원 | 2018.05.17
일반생물학 - DNA 추출 및 PCR & PCR 결과 확인(전기영동)
well에 넣고, PCR product 3ul를 두 번째 well부터 순서대로 넣는다.(2) 미리 준비된 0.8% gel에는 HindⅢ marker 5ul를 첫 번째 well에 넣고, DNA 추출액 5ul를 2ul loading dye tube에 넣어 혼합한 후에 두 번째 well부터 5ul씩 순서대로 넣는다.(3) 전기영동장치 전원코드를 연결하고 뚜겅 홈이 금속에 잘 들어가도록 맞춰 덮은
8페이지 | 1,500원 | 2017.03.17
primero del artículo 13, podrán ejercer el derecho de sufragio en los casos y formas que determine la ley.6.- CARACTERISTICAS DEL SUFRAGIO Y CONVOCATORIA A VOTACION POPULAR:ARTICULO 15 : En las votaciones populares, el sufragio será personal, igualitario y secreto. Para los ciudadanos será, además, obligatorio.Sólo podrá convocarse a votación popular para las elecciones y plebiscitos e
139페이지 | 4,000원 | 2016.05.11